View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11956_low_15 (Length: 248)
Name: NF11956_low_15
Description: NF11956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11956_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 37982961 - 37982721
Alignment:
| Q |
7 |
gagaagaagagggaaagcgaag---tttcatctggagggagattggaatattttgtgaatgttagtccctcctaaagtttgtaatctctagtttcgagta |
103 |
Q |
| |
|
||||||||||||||||| |||| |||||| || |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37982961 |
gagaagaagagggaaagtgaagaagtttcatttgaagggagattgaaatattttgtgaatgttagtccctcctaaagtttgta-tctctagtttcgagta |
37982863 |
T |
 |
| Q |
104 |
tatggaggagttgtttgtccgactcgtcttagattacatgataaatatattttatgtcctctcaattgtgaactttgtccagaaccgatgaagagtgatc |
203 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37982862 |
tatggag---ttgtttgtctgactcgtcgtagattacatgataaatatattttatgtcctctcaattgtgaactttgtccagaaccgatgaagagtgatc |
37982766 |
T |
 |
| Q |
204 |
agcannnnnnncccaatgtgataagagtgtccaatgctggcatat |
248 |
Q |
| |
|
| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
37982765 |
aacatttttttcccaatgtgataagagtgcccaatgctggcatat |
37982721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University