View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_high_11 (Length: 254)
Name: NF11957_high_11
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 39553516 - 39553759
Alignment:
| Q |
1 |
taaatgtcaagatcatatcacttttacatgatataaaacaagcttttcaacccaaaaaatatatataatactagccatgttatgaattattcacatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39553516 |
taaatgtcaagatcatatcacttttacatgatataaaactagcttttcaacccaaaaaatatatataatactagccatgttatgaattattcacatttta |
39553615 |
T |
|
| Q |
101 |
tcatgtctatatgaaagaatcattccttcatgaacctaagacattgtaatatgttatattatgcatcggatttggtccnnnnnnnnngttatattatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39553616 |
tcatgtctatatgaaagaatcattccttcatgaacctaagatattgtaatatgttatattatgcatcggatttggtaaaaaaaaaaagttatattatgca |
39553715 |
T |
|
| Q |
201 |
tcggatgatattttttaggattagatgcagttttgatctctctg |
244 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39553716 |
tcggatgatattttttgggattagatgcagttttgatctctctg |
39553759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University