View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_high_14 (Length: 249)
Name: NF11957_high_14
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 23119000 - 23118757
Alignment:
| Q |
1 |
aaattcggaaaaattgctgaggaaaatcaatattttgagcaatttaatactcctccagatcaccctccggaacaaaatctagatcgatctccgattcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23119000 |
aaattcggaaaaattgctgaggaaaatcaatattttgagcaatttaatactcctccagatcactctccggaacaaaatctagatcgatctccgattcttt |
23118901 |
T |
|
| Q |
101 |
aggagtatcaacaactgcttgaagactttggaaatcaatatgctgccttttctgctcaagaagccagtgatgtgcttaagagcttaacatcacacccttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23118900 |
aggagtatcaacaactgcttgaagactttggaaatcaatatgctgccttttctgctcaaaaagccagtgatgtgcttaagagcttcacatcacacccttt |
23118801 |
T |
|
| Q |
201 |
cacaacccaacaggttactaagttgtctcatctattcatctcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118800 |
cacaacccaacaggttactaagttgtctcatctattcatctcac |
23118757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University