View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_high_16 (Length: 241)
Name: NF11957_high_16
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 27820195 - 27820406
Alignment:
| Q |
19 |
caagaagcttcaaactcgcgagatttctcctaaacctcatcgttcctttgttgctgctacttcaccacatagattccagaacatgcgtttaactcatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27820195 |
caagaagcttcaaactcgcgagatttctcctaaacctcatcgttcctttgttgctgctacttcaccacatagattccagaacatgcgtttgactcatcaa |
27820294 |
T |
 |
| Q |
119 |
tttgatactcatgatcctaaacatcattcttctccttcaccctttttgccttttttgatgaaaagaactaaggttgttgagatcgttgctgctaagaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27820295 |
tttgatactcatgatcctaaacatcattcttctccttcaccctttttgccttttttgatgaaaagaactaaggttgttgagatcgttgctgctaagaata |
27820394 |
T |
 |
| Q |
219 |
ttgtctctgctc |
230 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
27820395 |
ttgtctttgctc |
27820406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 42534844 - 42534937
Alignment:
| Q |
49 |
taaacctcatcgttcctttgttgctgctacttcaccacatagattccagaacatgcgtttaactcatcaatttgatactcatgatcctaaacat |
142 |
Q |
| |
|
||||| ||||||| | |||||| |||||||| | |||||||||||||| ||||||||||| | |||| || |||| |||||| || |||||||| |
|
|
| T |
42534844 |
taaacatcatcgtgcttttgttactgctactactccacatagattccaaaacatgcgtttcagtcatgaacttgacactcatcattctaaacat |
42534937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University