View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_high_22 (Length: 212)
Name: NF11957_high_22
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 34860108 - 34859930
Alignment:
| Q |
19 |
ctgatgatagcgctacttttcccgttacttcacttgaggatgctcgtagaattccataggatctattgtctcttatgtgtaggtgcatatctgaaactca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34860108 |
ctgatgatagcgctacttttcccgttacttcacttgaggatgctcgtagaattccataggatctattgtcgcttatgtgtaggtgcatatctgaaactca |
34860009 |
T |
|
| Q |
119 |
ccagatgtgtgttactccaacggagttcatacgtaggaagctagatgtttttgaagatccttattgctcgtcttctgtg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860008 |
ccagatgtgtgttactccaacggagttcatacgtaggaagctagatgtttttgaagatccttattgctcgtcttctgtg |
34859930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University