View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_high_9 (Length: 273)
Name: NF11957_high_9
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 83 - 254
Target Start/End: Original strand, 10393686 - 10393857
Alignment:
| Q |
83 |
gtaatcccaaaggggtgaaaagatggtgcgaaggaaggacctcttcaaaccaccatgcgccaagtctgcatcgtgaagaaaagagcttggaattggagga |
182 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393686 |
gtaatcccaaaggggtgaaaagatgatgtgaaggaaggacctcttcaaaccaccatgcaccaagtctgcatcgtgaagaaaagagcttggaattggagga |
10393785 |
T |
 |
| Q |
183 |
agagagacatcgtggtgtttagggttttagagagaagtcagggaggaagtcaagtttaaagatctcatgatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393786 |
agagagacatcgtggtgtttagggttttagagagaagtcagggaggaagtcaagtttaaagatctcatgatg |
10393857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University