View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11957_low_1 (Length: 598)
Name: NF11957_low_1
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11957_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 2e-94; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 254 - 448
Target Start/End: Original strand, 2245084 - 2245279
Alignment:
| Q |
254 |
attaaccgtctcgtggtcgaggaccctatagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat |
353 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245084 |
attaaccgtctcgtggtcgaggaccctttagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat |
2245183 |
T |
 |
| Q |
354 |
tcgttgtctgataagcaactatgctcttc-ttgttgctaactataaatgcaccccacctatcctatcacttgcagcaacccatacatacacacatt |
448 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2245184 |
tcgttgtctgataagcaactatgctcttctttgttgctaactataaatgcaccccacctatcctatcacttgctgcaacccatacattcacacatt |
2245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 491 - 598
Target Start/End: Original strand, 2245314 - 2245420
Alignment:
| Q |
491 |
aaccttcactaactcataaagaaggcaccaannnnnnnnaagtaaccttcttcctaataccatagtcatggagggaatgcaaaacagagatattggatca |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
2245314 |
aaccttcactaactcataaagaaggcaccactttttttca-gtaaccttcttcctaataccatagtcatggatggaattcaaaacagagatattggatca |
2245412 |
T |
 |
| Q |
591 |
tgtttatc |
598 |
Q |
| |
|
|||||||| |
|
|
| T |
2245413 |
tgtttatc |
2245420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 187 - 215
Target Start/End: Original strand, 2245013 - 2245041
Alignment:
| Q |
187 |
tgtttaaccgaacaaattaaacaagttac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2245013 |
tgtttaaccgaacaaattaaacaagttac |
2245041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University