View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_29 (Length: 380)
Name: NF11959_high_29
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 166 - 371
Target Start/End: Original strand, 29649881 - 29650086
Alignment:
| Q |
166 |
gttactcaccaatgaagaaagtaattgcatgtgattcttttttatgatgaattggtctaaggtatttcattgcctttctatgatcacctttagcaaaatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649881 |
gttactcaccaatgaagaaagtaattgcatgtgattcttttttatgatgaattggtctaaggtatttcattgcctttctatgatcacctttagcaaaatt |
29649980 |
T |
 |
| Q |
266 |
cttgacaaatagttcctccacttcatccatgaacttcaccacctataaattttaggacaaacaagtaaataaagttggttcacaaagtaaaatactactc |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649981 |
cttgacaaatagttcctccacttcatccatgaacttcaccacctataaattttaggacaaacaagtaaataaagttggttcacaaagtaaaatactactc |
29650080 |
T |
 |
| Q |
366 |
tctcat |
371 |
Q |
| |
|
|||||| |
|
|
| T |
29650081 |
tctcat |
29650086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 17 - 119
Target Start/End: Original strand, 29649732 - 29649834
Alignment:
| Q |
17 |
acatacaaggagctagtgactaagggggtccatgttatgttttctttggattgtagtgatcataaaacaaacaaactaaaggctctttaatacaatgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649732 |
acatacaaggagctagtgactaagggggtccatgttatgttttctttggattgtagtgatcataaaacaaacaaactaaaggctctttaatacaatgatt |
29649831 |
T |
 |
| Q |
117 |
aac |
119 |
Q |
| |
|
||| |
|
|
| T |
29649832 |
aac |
29649834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University