View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_35 (Length: 345)
Name: NF11959_high_35
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 91 - 265
Target Start/End: Complemental strand, 8270819 - 8270645
Alignment:
| Q |
91 |
gtagtggtttcaacactcgttctaagctttcttatttgtttcaatgtattttggtttatgtcctccaatcttgtttcttgttcatgattagtttacttga |
190 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
8270819 |
gtagttgtttcaacactcgttataagctttcttatttgtttcaatgtattttggtttatgtcctccaatcttgtttattgttcatgattagtttatttga |
8270720 |
T |
|
| Q |
191 |
ggagtaactctgcataaaatattctgtttataataactcattataaaaaattatatttcacaaatttaaccattg |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8270719 |
ggagtaactctgcataaaattttctgtttataataactcattataaaaaattatatttcacaaatttaaccattg |
8270645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University