View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_40 (Length: 304)
Name: NF11959_high_40
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 43758223 - 43758510
Alignment:
| Q |
1 |
ccacccactttttatcacatactcatgtatactccttccctctccaatagcagaaagagccgagcacgccttaagaacaaacggtaaagtaaaattatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758223 |
ccacccactttttatcacatactcatgtatactccttccctctccaatagcagaaagagccgagcacgccttaagaacaaacggtaaagtaaaattatcg |
43758322 |
T |
|
| Q |
101 |
ggcctgagcccatagtcaagcatattgtgatatagcataatggcattatcatgaggcccattccaggcataaccgcgaatcaaaacattccacagaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758323 |
ggcctgagcccatagtcaagcatcttgtgatatagtataatggcattatcatgaggcccattccaggcataaccgcgaatcaaaacattccacagaaaca |
43758422 |
T |
|
| Q |
201 |
aattctgtttgggaattttatcaaacaggttacgtgcattacgaagacaattcgaaaccgcataaagatggacaagtttagtggctaa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758423 |
aattctgtttgggaattttatcaaacaggttacgtgcattaagaagagaattcgaaaccgcataaagatggacaagtttagtggctaa |
43758510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University