View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_41 (Length: 293)
Name: NF11959_high_41
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 3491040 - 3491315
Alignment:
| Q |
1 |
gtgagactgaaaagttggctgaaactgaaagtgagaaaagtagtccaacagaaaactatggaaacgaaaacaaggaaactttggagagattggatttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491040 |
gtgagactgaaaagttggctgaaactgaaagtgagaaaagttgtccaacagaaaactatggaaacgaaaacaaggaaactttggagagattggatttgga |
3491139 |
T |
|
| Q |
101 |
ggttgaggagaatgagaaacctcaaaaggttgagatggaaaatttggtggaaaccgaagtcgagaaaaatagtccaagtaagcttaaactcaatggagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491140 |
agttgaggagaatgagaaacctcaaaaggttgagatggaaaatttggctgaaaccgaagtcgagaaaaatagtccaagtaagcttaaactcaatggagga |
3491239 |
T |
|
| Q |
201 |
aaagtgttgaaggaaaatgctactgatggtgatgaaactgttgctataactggtcttgagaaaattgttttgagac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491240 |
aaagtgttgaaggaaaatgctactgatggtgatgaaactgttgctataactggtcttgagaaaattgttttgagac |
3491315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 49 - 135
Target Start/End: Original strand, 3490956 - 3491045
Alignment:
| Q |
49 |
cagaaaactatggaaacgaaaacaaggaaactttggagagattg---gatttggaggttgaggagaatgagaaacctcaaaaggttgaga |
135 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
3490956 |
cagaaaacgatggaaaagaaaacaaggaaactttggagacattgttggatttggaagttgaggagaatgagaaacctcaaaagggtgaga |
3491045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University