View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_46 (Length: 270)
Name: NF11959_high_46
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 226619 - 226384
Alignment:
| Q |
11 |
caaaggctaaaaacatagacatagattatatgttatactctgaagtcttagtaaaaagcttccaaccctgtcattaagattgtatttaccaaatagttca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
226619 |
caaaggctaaaaacatagacatagattatatgttatactctgaagtcttggtaaaaagcttccaaccctgtcattaagattgtatttgccaaatagttca |
226520 |
T |
 |
| Q |
111 |
tcatacttgatggtaaatgtatgtttagtaacatggtgggtttatcaaaatcacgatgagccacgacaactcgctgctatcttgccaaaccacagtgata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226519 |
tcatacttgatggtaaatgtatgtttagtaacatggtgggtttatcaaaatcacgatgagccacgacaactcgctgctatcttgccaaaccacagtgata |
226420 |
T |
 |
| Q |
211 |
ttaaacctgcactaaatggaacttcgaacaatccat |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
226419 |
ttaaacctgcactaaatgaaacttcgaacaatccat |
226384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University