View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_63 (Length: 239)
Name: NF11959_high_63
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 10930329 - 10930125
Alignment:
| Q |
19 |
gttgttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaactcagaagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10930329 |
gttgttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaattcagaagat |
10930230 |
T |
 |
| Q |
119 |
gatatttgggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtatccaccgccgggatat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10930229 |
gatatttgggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtttccaccgccgggatat |
10930130 |
T |
 |
| Q |
219 |
ctgtg |
223 |
Q |
| |
|
||||| |
|
|
| T |
10930129 |
ctgtg |
10930125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University