View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11959_high_63 (Length: 239)

Name: NF11959_high_63
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11959_high_63
NF11959_high_63
[»] chr5 (1 HSPs)
chr5 (19-223)||(10930125-10930329)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 10930329 - 10930125
Alignment:
19 gttgttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaactcagaagat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
10930329 gttgttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaattcagaagat 10930230  T
119 gatatttgggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtatccaccgccgggatat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
10930229 gatatttgggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtttccaccgccgggatat 10930130  T
219 ctgtg 223  Q
    |||||    
10930129 ctgtg 10930125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University