View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_64 (Length: 237)
Name: NF11959_high_64
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 31332272 - 31332473
Alignment:
| Q |
21 |
gaaccgtcttgattttaatcgatagatcaccgatatctcgaatgcggggaatccttaattatcaatgtgaattggtttttatcatcaattccatggataa |
120 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31332272 |
gaaccgtct-gattttaatcgaaagatcattgatatctcgaatgcggggaatccttagttatcaatgtgaattggtttttatcatcaattccatggataa |
31332370 |
T |
 |
| Q |
121 |
ttttgagtgacagaaatttgaaatctccaaaatagatactattgcagctaccaaagttgattcactatttaccaatttctatgtaattatgatgactagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31332371 |
ttttgagtgacagaaatttgaaatctccaaaatagatactattgcagctaccaaagttgattcactatttaccaatttctatgtaattatgatgactagt |
31332470 |
T |
 |
| Q |
221 |
tag |
223 |
Q |
| |
|
||| |
|
|
| T |
31332471 |
tag |
31332473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University