View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_high_67 (Length: 206)
Name: NF11959_high_67
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_high_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 15702573 - 15702760
Alignment:
| Q |
11 |
aagcagagagacaacctgttgagaacagatgaggttttgtggaggcagagaagtatggcagtatggttgaaggatggtgatagaaatacaaaaattttcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15702573 |
aagcagagagacaacctgttgagaacagataaggttttgtggaggcagaggagtagggcagtatggttgaaggatggggatagaaatacaaaaattttcc |
15702672 |
T |
 |
| Q |
111 |
atagcaaggccgaccagaggaggaaagcaaatgcaattaagaaactgaaagatgtcgacggagtgtggtggaaaggtgatgtccatct |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
15702673 |
atagcaaggccgaccagaggaggaaaacaaatgcaattaagaaactgaaagatgtcttcggagtgtggtggaaaggtgatgaccatct |
15702760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 112
Target Start/End: Original strand, 23378347 - 23378379
Alignment:
| Q |
80 |
aaggatggtgatagaaatacaaaaattttccat |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
23378347 |
aaggatggtgatagaaatacaaaaaatttccat |
23378379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University