View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_low_38 (Length: 319)
Name: NF11959_low_38
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_low_38 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 189 - 319
Target Start/End: Complemental strand, 32620846 - 32620715
Alignment:
| Q |
189 |
gtcttgagacgagacaaagtaacaagcatcatcaaaaacttacgtacaaaattgtgagatctaaagtttgaccacatgtgacggtgtttagcttaa-atc |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
32620846 |
gtcttgagacgagacaaagtaacgagcatcatctaaaacttatgtacaaaacggtgagatctaaagtttgaacacatgtgacggtgtttagcttaatatc |
32620747 |
T |
|
| Q |
288 |
agcattgttagttgagttaaatcttccgaatt |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
32620746 |
agcattgttagttgagttagatcttccgaatt |
32620715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 32621025 - 32620922
Alignment:
| Q |
8 |
ggagaggtttggac-aagaatgaaagtagaaatatcttaagaacnnnnnnntggataggccacgtcgtctttcctgcacaatcacaatggctggacacaa |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32621025 |
ggagaggtttggaccaagaatgaaagtagaaatatcttaagaacagaaaaatggataggccacgtc---tttcctgcacaatcacaatggctggacacaa |
32620929 |
T |
|
| Q |
107 |
tagggga |
113 |
Q |
| |
|
||||||| |
|
|
| T |
32620928 |
tagggga |
32620922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University