View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11959_low_44 (Length: 274)
Name: NF11959_low_44
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11959_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 5 - 259
Target Start/End: Original strand, 1974631 - 1974885
Alignment:
| Q |
5 |
atccaaccttggattacaggacaagttaacattttttaaaggcactttgttttcataatttggtaacgacctatttgacccagacatggtttcaactttc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974631 |
atccaaccttggattacaggacaagttaacattttttaaaggcactttgttttcataatttggtaacgacctatttgacccagacatggtttcaactttc |
1974730 |
T |
|
| Q |
105 |
aaatattttctagccctgtcaaaataaactggtccagttgacatatgtgtatcttgcttagaacatattttctccataactttggaagaaccacccattt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974731 |
aaatattttctagccctgtcaaaataaactggtccagttgacatatgtgtatcttgcttagaacatattttctccataactttggaagaaccacccattt |
1974830 |
T |
|
| Q |
205 |
gaagaccaactctttcctttatagtcatttttggcttcaatgtcttattaggaag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974831 |
gaagaccaactctttcctttatagtcatttttggcttcaatgtcttattaggaag |
1974885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University