View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11959_low_54 (Length: 254)

Name: NF11959_low_54
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11959_low_54
NF11959_low_54
[»] chr7 (1 HSPs)
chr7 (1-239)||(49007916-49008154)


Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 49008154 - 49007916
Alignment:
1 acacttggtgctggttttgtacctaaaacagttttattaaattgcatgcttgcttttggattagtattgcacttaatgaaatccttgataagttctccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49008154 acacttggtgctggttttgtacctaaaacagttttattaaattgcatgcttgcttttggattagtattgcacttaatgaaatccttgataagttctccat 49008055  T
101 taattggattcnnnnnnntagatggaaacttagtttgaatgtaatatgttatatcctcagaactatttgatatgaaaacacccgcaacaacttttattct 200  Q
    |||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49008054 taattggattcaaaaaaatagatggaaacttagtttgaatgtaatatgttatatcctcagaactatttgatatgaaaacacccgcaacaacttttattct 49007955  T
201 gtccaagttatccacttgagtagcaagtgttcggttctt 239  Q
    |||||||||||||||||||||||||||||||||||||||    
49007954 gtccaagttatccacttgagtagcaagtgttcggttctt 49007916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University