View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11959_low_65 (Length: 237)

Name: NF11959_low_65
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11959_low_65
NF11959_low_65
[»] chr6 (1 HSPs)
chr6 (21-223)||(31332272-31332473)


Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 31332272 - 31332473
Alignment:
21 gaaccgtcttgattttaatcgatagatcaccgatatctcgaatgcggggaatccttaattatcaatgtgaattggtttttatcatcaattccatggataa 120  Q
    ||||||||| |||||||||||| ||||||  |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
31332272 gaaccgtct-gattttaatcgaaagatcattgatatctcgaatgcggggaatccttagttatcaatgtgaattggtttttatcatcaattccatggataa 31332370  T
121 ttttgagtgacagaaatttgaaatctccaaaatagatactattgcagctaccaaagttgattcactatttaccaatttctatgtaattatgatgactagt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31332371 ttttgagtgacagaaatttgaaatctccaaaatagatactattgcagctaccaaagttgattcactatttaccaatttctatgtaattatgatgactagt 31332470  T
221 tag 223  Q
    |||    
31332471 tag 31332473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University