View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11959_low_68 (Length: 206)

Name: NF11959_low_68
Description: NF11959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11959_low_68
NF11959_low_68
[»] chr6 (1 HSPs)
chr6 (11-198)||(15702573-15702760)
[»] chr2 (1 HSPs)
chr2 (80-112)||(23378347-23378379)


Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 15702573 - 15702760
Alignment:
11 aagcagagagacaacctgttgagaacagatgaggttttgtggaggcagagaagtatggcagtatggttgaaggatggtgatagaaatacaaaaattttcc 110  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||    
15702573 aagcagagagacaacctgttgagaacagataaggttttgtggaggcagaggagtagggcagtatggttgaaggatggggatagaaatacaaaaattttcc 15702672  T
111 atagcaaggccgaccagaggaggaaagcaaatgcaattaagaaactgaaagatgtcgacggagtgtggtggaaaggtgatgtccatct 198  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||||| ||||||    
15702673 atagcaaggccgaccagaggaggaaaacaaatgcaattaagaaactgaaagatgtcttcggagtgtggtggaaaggtgatgaccatct 15702760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 112
Target Start/End: Original strand, 23378347 - 23378379
Alignment:
80 aaggatggtgatagaaatacaaaaattttccat 112  Q
    ||||||||||||||||||||||||| |||||||    
23378347 aaggatggtgatagaaatacaaaaaatttccat 23378379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University