View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11960_low_12 (Length: 244)
Name: NF11960_low_12
Description: NF11960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11960_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 40638034 - 40637808
Alignment:
| Q |
1 |
cgaaatactatgcagtatattgtagtaataaatataagctaccttaagcacaaagtaaaagcttttacatatgttcggtnnnnnnnnnnnnnnnnncttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40638034 |
cgaaatactatgcagtatattgtagtaataattataagctaccttaagcacaaagtaaaagcttttacatatgttcgg---aaaaaaaaaaaaaaacttt |
40637938 |
T |
|
| Q |
101 |
atataatatgcaattaaatcggttatttgcattgaccnnnnnnnnnn-tcaattatttggttgttttgtgtttggaattcatagacaggtggaattcata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40637937 |
atataatatgcaattaaatcggttatttgcattgaccaaaaaaaaaaatcaattatttggttgttttgtgtttggaattcatagacaggtggaattcata |
40637838 |
T |
|
| Q |
200 |
gatcttctaagtcttttatgcatatgattt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40637837 |
gatcttctaagtcttttatgcatatgattt |
40637808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University