View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11961_high_12 (Length: 382)
Name: NF11961_high_12
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11961_high_12 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 213 - 382
Target Start/End: Original strand, 129536 - 129705
Alignment:
| Q |
213 |
tacccgtcctgtattatgagatttgagaaaaccaaagtcatacccaaaatgagtgaaagcagatacaactgtgaaaattagtattaatcgcaccccctag |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
129536 |
tacccgtcctgtattatgagatttgagaaaaacaaagtcatacccaaaatgagtgaaagcagataaaactgtgaaaattagtattaatcgcaccccctag |
129635 |
T |
 |
| Q |
313 |
tgaagattgttttctttcccttcacttagccttacccaccaaccccttctcacccctgtctgtcgtgtta |
382 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
129636 |
tgaagattgttttctttcccttcacttaaccttacccaccaaccccttctcacccctgtctgtcgtgtta |
129705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University