View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11961_high_20 (Length: 222)
Name: NF11961_high_20
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11961_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 36318672 - 36318797
Alignment:
| Q |
18 |
catgtatattgattttttgattattttgactgctccttgttgtcatttgtgtgtatttcagaagaaaagcagctttgtctttgtaactttgtgcctattc |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36318672 |
catgtatattgattttttgattatgatgactgctccgtgttgtcatttgtgtgtatgtcagaagaaaagcaactttgtctttgtaaatttgtgcctatta |
36318771 |
T |
 |
| Q |
118 |
acacatacatggctatctgagaataa |
143 |
Q |
| |
|
|||||||||||| |||| || ||||| |
|
|
| T |
36318772 |
acacatacatgggtatccgataataa |
36318797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 142 - 208
Target Start/End: Original strand, 36319152 - 36319218
Alignment:
| Q |
142 |
aactttgttcagtgttgtcattctatcaatatttcatcttttatccctcttaataatgacttctctg |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36319152 |
aactttgtttcgtgttgtcattctatcaatatttcatcttttatccctcttgataatgacttctctg |
36319218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University