View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11961_low_10 (Length: 412)
Name: NF11961_low_10
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11961_low_10 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 102 - 321
Target Start/End: Complemental strand, 26454 - 26235
Alignment:
| Q |
102 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
26355 |
T |
 |
| Q |
202 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattcatttgtttccttcgattcctttcaacag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26354 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattcatttgtttccttcgattcctttcaacag |
26255 |
T |
 |
| Q |
302 |
ctatgtgagtcatacgttga |
321 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26254 |
ctatgtgagtcatacgttga |
26235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University