View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11961_low_17 (Length: 307)
Name: NF11961_low_17
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11961_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 86 - 292
Target Start/End: Complemental strand, 45608520 - 45608330
Alignment:
| Q |
86 |
gaggactgaggaattaggaattgttatcaccattatttacatagtaacagtctctacaaagtagtcatagttgaaaatatttgagtgcatggtatcatgg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| | || ||||||||||||||| |||||||||||||| |
|
|
| T |
45608520 |
gaggactgaggaattaggaattgttatcaccattatttacgtagtaaca-tgact---------------ttgaaaatatttgagcgcatggtatcatgg |
45608437 |
T |
|
| Q |
186 |
ttagtttgataaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccatgatacctgttaagcactttattgatg |
285 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
45608436 |
ttagtttgattaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccgtgatacctattaagcactttattgatg |
45608337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 246
Target Start/End: Original strand, 50528495 - 50528525
Alignment:
| Q |
216 |
attttgttgaagctataaattatagtttttg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50528495 |
attttgttgaagctataaattatagtttttg |
50528525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 229
Target Start/End: Complemental strand, 5433486 - 5433445
Alignment:
| Q |
188 |
agtttgataaaatcacaatgacgctatgattttgttgaagct |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5433486 |
agtttgataaaatcacaatgtcgctatgattttgttgaagct |
5433445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University