View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11961_low_17 (Length: 307)

Name: NF11961_low_17
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11961_low_17
NF11961_low_17
[»] chr1 (2 HSPs)
chr1 (86-292)||(45608330-45608520)
chr1 (216-246)||(50528495-50528525)
[»] chr3 (1 HSPs)
chr3 (188-229)||(5433445-5433486)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 86 - 292
Target Start/End: Complemental strand, 45608520 - 45608330
Alignment:
86 gaggactgaggaattaggaattgttatcaccattatttacatagtaacagtctctacaaagtagtcatagttgaaaatatttgagtgcatggtatcatgg 185  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |  ||               ||||||||||||||| ||||||||||||||    
45608520 gaggactgaggaattaggaattgttatcaccattatttacgtagtaaca-tgact---------------ttgaaaatatttgagcgcatggtatcatgg 45608437  T
186 ttagtttgataaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccatgatacctgttaagcactttattgatg 285  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||    
45608436 ttagtttgattaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccgtgatacctattaagcactttattgatg 45608337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 246
Target Start/End: Original strand, 50528495 - 50528525
Alignment:
216 attttgttgaagctataaattatagtttttg 246  Q
    |||||||||||||||||||||||||||||||    
50528495 attttgttgaagctataaattatagtttttg 50528525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 229
Target Start/End: Complemental strand, 5433486 - 5433445
Alignment:
188 agtttgataaaatcacaatgacgctatgattttgttgaagct 229  Q
    |||||||||||||||||||| |||||||||||||||||||||    
5433486 agtttgataaaatcacaatgtcgctatgattttgttgaagct 5433445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University