View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11961_low_19 (Length: 240)
Name: NF11961_low_19
Description: NF11961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11961_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 129806 - 130028
Alignment:
| Q |
1 |
caaaaccagcaccaaagaagtctcaattgaaccatcatcaatatggtttacaagaaagacgagaagtattggtgtaatcaagtgttcaattgaacgcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
129806 |
caaaaccagcaccaaagaagtctcaattgaaccatcatcaatatggtttacaagaaagacgagaagtattggtgtaatcaagtgttcaattgaacgcagt |
129905 |
T |
 |
| Q |
101 |
aatagcagtgatggaaagaaaggagtagtatcgaattcaaattatgttgtacctttggatgattcattttcattctcaaattcatcttccaccattactc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
129906 |
aatagcagtgatggaaagaaaggagtagtttcgaattcaaattatgttgtacctttggatgattcattttcattctcaaattcatcttccaccattactc |
130005 |
T |
 |
| Q |
201 |
gccctttagctgagattcttaga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
130006 |
gccctttagctgagattcttaga |
130028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University