View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11962_high_10 (Length: 204)
Name: NF11962_high_10
Description: NF11962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11962_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 31040779 - 31040632
Alignment:
| Q |
1 |
caattatttgattaagtctttgcctcagataccttacacacctctcttacttctccactattttcattacaccttctttcttgctgcaatgtattcatta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31040779 |
caattatttgattaagtctttgcatcagataccttacacacctctcttacttctccactattttcattacaccttctttcttgctgcaatgtattcatta |
31040680 |
T |
 |
| Q |
101 |
tttctatgaatactcttatttagtgcttccactgttcccattactctg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31040679 |
tttctatgaatactcttatttagtgcttccactgttcccattactctg |
31040632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University