View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11962_high_2 (Length: 596)
Name: NF11962_high_2
Description: NF11962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11962_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 205 - 586
Target Start/End: Original strand, 40903443 - 40903824
Alignment:
| Q |
205 |
cactgaattatgtgattttcttaactgaatcccttgtgtccggtgtttgtattcgtgtttcatatcatactacttactaactgaatcccttgattgtgtt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903443 |
cactgaattatgtgattttcttaactgaatcccttgtgtccggtgtttgtactcgtgtttcatatcatactacttactaactgaatcccttgattgtgtt |
40903542 |
T |
 |
| Q |
305 |
tttgaaccagctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggtgaagtccgtctcaagatac |
404 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40903543 |
ttggaaccagctgcggttgcatgggaagcggggaagccgctggtgatggaagaagtagaggtggctccaccgcaggccggtgaagtccgtctcaagatac |
40903642 |
T |
 |
| Q |
405 |
tcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtannnnnnngattacataacacggcgggtgcttagttttcttacacaaaagt |
504 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903643 |
tcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtatttttttgattacataacacggcgggtgcttagttttcttacacaaaagt |
40903742 |
T |
 |
| Q |
505 |
taatttacgtaaaattcttcttaggttttcatgttttgttttgcattgcagtgatttaatatggttttcttgttttcctttg |
586 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903743 |
taatttatgtaaaattcttcttaggttttcatgttctgttttgcattgcagtgatttaatatggttttcttgttttcctttg |
40903824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 286 - 454
Target Start/End: Original strand, 40898848 - 40899016
Alignment:
| Q |
286 |
tgaatcccttgattgtgtttttgaaccagctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggt |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40898848 |
tgaatcccttgattgtgtttttgaaccagctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcaccaccgcaggccggt |
40898947 |
T |
 |
| Q |
386 |
gaagtccgtctcaagatactcttcacctccctttgtcacactgatgtttacttctgggaagctaaggta |
454 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40898948 |
gaagtccgtctcaagatactcttcacctccctttgtcacaccgatgtttacttctgggaagctaaggta |
40899016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 40903227 - 40903373
Alignment:
| Q |
1 |
tcacccattcgattccattctaaattttctgttcattcatcatgtcaaacactgctggtcagatcatcaagtgtagaggtaccatctatttatctcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903227 |
tcacccattcgattccattctaaattttctgttcattcatcatgtccaacactgctggtcagatcatcaagtgtagaggtaccatctatttatctcaaat |
40903326 |
T |
 |
| Q |
101 |
tttgttttgatcttgttttctagaatattttaatcatcgatccatcc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903327 |
tttgttttgatcttgttttctagaatattttaatcatcgatccatcc |
40903373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 312 - 454
Target Start/End: Original strand, 40879949 - 40880091
Alignment:
| Q |
312 |
cagctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcac |
411 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879949 |
cagctgcggttgcatgggaggcagggaagccactggtgatggaggaagtggaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcac |
40880048 |
T |
 |
| Q |
412 |
ctccctttgtcacactgatgtttacttctgggaagctaaggta |
454 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40880049 |
ctctctttgtcacactgatgtttacttctgggaagctaaggta |
40880091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 527 - 573
Target Start/End: Original strand, 40899248 - 40899294
Alignment:
| Q |
527 |
aggttttcatgttttgttttgcattgcagtgatttaatatggttttc |
573 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
40899248 |
aggttttgatgttctgttgtgcattgcagtgatttaatatggttttc |
40899294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 462 - 525
Target Start/End: Original strand, 40899125 - 40899188
Alignment:
| Q |
462 |
gattacataacacggcggg-tgcttagttttcttacacaaaagttaatttacgtaaaattcttct |
525 |
Q |
| |
|
|||||||||||||| ||| |||||||||| || ||| ||||||||||||| ||||||||||||| |
|
|
| T |
40899125 |
gattacataacacgttggggtgcttagttt-ctaacaaaaaagttaatttatgtaaaattcttct |
40899188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University