View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11962_high_7 (Length: 348)

Name: NF11962_high_7
Description: NF11962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11962_high_7
NF11962_high_7
[»] chr8 (3 HSPs)
chr8 (22-114)||(31670896-31670988)
chr8 (283-343)||(31671199-31671259)
chr8 (32-107)||(29126334-29126408)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 22 - 114
Target Start/End: Original strand, 31670896 - 31670988
Alignment:
22 aagttagaatgtaattcaaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctatagtgttgatatcttgtgag 114  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
31670896 aagttcgaatgtaattccaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctacagtgttgatatcttgtgag 31670988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 31671199 - 31671259
Alignment:
283 cacatcaaagtctcgactcactttccctatgttagttctttctattgtttttcttctctct 343  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||    
31671199 cacatcaaagtctcgactcactttccctatgttagttctttctattatttttcttcgctct 31671259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 107
Target Start/End: Original strand, 29126334 - 29126408
Alignment:
32 gtaattcaaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctatagtgttgatatc 107  Q
    |||||| |||||| || ||||| | ||||||||||| |  ||||||||||||| ||||||||| ||||||||||||    
29126334 gtaatttaaaacacgaaacaaaaatattgagtaaaa-atatttagaaatatttgttgtttctagagtgttgatatc 29126408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University