View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11962_low_10 (Length: 226)
Name: NF11962_low_10
Description: NF11962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11962_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 15212926 - 15212856
Alignment:
| Q |
18 |
atattcaattaatcatactgttcctgannnnnnn-agctgctttagcagccatcaaaacctcggaattgaa |
87 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15212926 |
atattcaattaatcatactgttcctgattttttttagctgctttagcagccatcaaaacctcggaattgaa |
15212856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 15212857 - 15212824
Alignment:
| Q |
178 |
aacacattgtatgtaaccacattcgttcatctca |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
15212857 |
aacacattgtatgcaaccacattcgttcatctca |
15212824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University