View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11962_low_7 (Length: 348)
Name: NF11962_low_7
Description: NF11962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11962_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 22 - 114
Target Start/End: Original strand, 31670896 - 31670988
Alignment:
| Q |
22 |
aagttagaatgtaattcaaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctatagtgttgatatcttgtgag |
114 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31670896 |
aagttcgaatgtaattccaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctacagtgttgatatcttgtgag |
31670988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 31671199 - 31671259
Alignment:
| Q |
283 |
cacatcaaagtctcgactcactttccctatgttagttctttctattgtttttcttctctct |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
31671199 |
cacatcaaagtctcgactcactttccctatgttagttctttctattatttttcttcgctct |
31671259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 107
Target Start/End: Original strand, 29126334 - 29126408
Alignment:
| Q |
32 |
gtaattcaaaacatgagacaaagaaattgagtaaaagagttttagaaatattttttgtttctatagtgttgatatc |
107 |
Q |
| |
|
|||||| |||||| || ||||| | ||||||||||| | ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29126334 |
gtaatttaaaacacgaaacaaaaatattgagtaaaa-atatttagaaatatttgttgtttctagagtgttgatatc |
29126408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University