View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11963_high_3 (Length: 247)
Name: NF11963_high_3
Description: NF11963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11963_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 373344 - 373172
Alignment:
| Q |
11 |
gatggacatcaattttaatcaatttttcatgccttgatatagcacatgatattagaaacgacaataggacgtcgagtggggcgagttttgcttttctcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373344 |
gatggacatcaattttaatcaatttttcgtgccttgttatagcacatgatattagaaacgacaataggacgtcgagtggggcgagttttgcttttctcat |
373245 |
T |
|
| Q |
111 |
ccccatatcatactctcatatactcaactggaatgagaaatcaaatcttatctccgttccgacgggtttgagt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
373244 |
ccccatatcatactctcatatactcaactggaatgagaaatcaaatcttatctccgtcccgacgggtttgagt |
373172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 373141 - 373108
Alignment:
| Q |
214 |
caatgaatattttcttaataacaaaaagtatatt |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
373141 |
caatgaatattttcttaataaaaaaaagtatatt |
373108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University