View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11964_low_8 (Length: 243)

Name: NF11964_low_8
Description: NF11964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11964_low_8
NF11964_low_8
[»] chr1 (3 HSPs)
chr1 (18-243)||(15884944-15885169)
chr1 (18-242)||(12637879-12638103)
chr1 (18-230)||(12610879-12611091)
[»] scaffold0059 (1 HSPs)
scaffold0059 (37-240)||(63031-63234)
[»] chr3 (2 HSPs)
chr3 (84-124)||(23018180-23018220)
chr3 (156-224)||(23025269-23025337)


Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 15885169 - 15884944
Alignment:
18 aggaaacagttcacctatgtcaaaacctcctgcaattgattctcccttccccaaagacgtgaactcttcttggtctttgcatttgtttccaaatgcagcc 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
15885169 aggaaacagttcacctatgtcaaaacctccagcaattgattctcccttccccaaagacgcgaactcttcttggtctttgcatttgtttccaaatgcagcc 15885070  T
118 cttgaaaggatagcaaatgtcgatgaaactacaagttcagtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacactt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885069 cttgaaaggatagcaaatgtcgatgaaactacaagttcagtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacactt 15884970  T
218 cttctcttattggatggaatgaactc 243  Q
    ||||||||||||||||||||||||||    
15884969 cttctcttattggatggaatgaactc 15884944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 12637879 - 12638103
Alignment:
18 aggaaacagttcacctatgtcaaaacctcctgcaattgattctcccttccccaaagacgtgaactcttcttggtctttgcatttgtttccaaatgcagcc 117  Q
    |||||||| |||||||||||||||||||||| ||| ||||||||| ||  |||| ||   || || ||||||| ||||||||||||||||||| ||||||    
12637879 aggaaacaattcacctatgtcaaaacctcctccaactgattctccatttgccaacgatacgagctgttcttggcctttgcatttgtttccaaacgcagcc 12637978  T
118 cttgaaaggatagcaaatgtcgatgaaactacaagttcagtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacactt 217  Q
    |||| |   ||||  |   | |||| ||||||   || ||||| |||||||| ||| ||||| |  ||| |||| ||||||||||||||||| ||| |||    
12637979 cttgtagtaatagtcataattgatgtaactacggcttgagtgatgttgatgggtgatccttgttgtgaatcaatacttttgatgagattggtgaactctt 12638078  T
218 cttctcttattggatggaatgaact 242  Q
    |||||||||| ||  ||||||||||    
12638079 cttctcttataggccggaatgaact 12638103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 12610879 - 12611091
Alignment:
18 aggaaacagttcacctatgtcaaaacctcctgcaattgattctcccttccccaaagacgtgaactcttcttggtctttgcatttgtttccaaatgcagcc 117  Q
    |||||| | |||| ||||||||||||||||||||||||||||||| |  || | |||    |||||||||  | |||||| |||| | ||||| ||||||    
12610879 aggaaataattcagctatgtcaaaacctcctgcaattgattctccatctccaatagatccaaactcttctctgcctttgcctttgctgccaaacgcagcc 12610978  T
118 cttgaaaggatagcaaatgtcgatgaaactacaagttcagtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacactt 217  Q
     ||| || ||||| |||||| |||||||||||||| | ||| |  |||| ||  |||||||| | |||| ||||| |||| | ||||||| ||| | |||    
12610979 tttgtaatgatagaaaatgttgatgaaactacaagctgagttatattgacgggcgacccttgttgcgaatcaatcttttttacgagattgttaagctctt 12611078  T
218 cttctcttattgg 230  Q
    |||||||||||||    
12611079 cttctcttattgg 12611091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0059
Description:

Target: scaffold0059; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 37 - 240
Target Start/End: Original strand, 63031 - 63234
Alignment:
37 tcaaaacctcctgcaattgattctcccttccccaaagacgtgaactcttcttggtctttgcatttgtttccaaatgcagcccttgaaaggatagcaaatg 136  Q
    |||||||||||| |||||||| ||   || ||||| ||||  |||| ||||||| ||||||||||||  ||||| ||||||||||||| ||||| ||       
63031 tcaaaacctcctccaattgatcctatatttcccaatgacgcaaactgttcttgggctttgcatttgtcgccaaacgcagcccttgaaatgatagaaatca 63130  T
137 tcgatgaaactacaagttcagtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacacttcttctcttattggatggaa 236  Q
    | | || || |||||||||||||| |||||  |   | ||||| | | || |||||||||||||||||||||  | | ||||||||||||||||  ||||    
63131 ttgttgtaagtacaagttcagtgatgttgacaggcaatccttgttgcaaatcaatccttttgatgagattggagagctcttcttctcttattggccggaa 63230  T
237 tgaa 240  Q
    ||||    
63231 tgaa 63234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 124
Target Start/End: Original strand, 23018180 - 23018220
Alignment:
84 ttcttggtctttgcatttgtttccaaatgcagcccttgaaa 124  Q
    |||||||||||||||||| || ||||| |||||||||||||    
23018180 ttcttggtctttgcatttattgccaaaggcagcccttgaaa 23018220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 23025269 - 23025337
Alignment:
156 agtgaggttgatggatgacccttgcttcgaaccaatccttttgatgagattggtaaacacttcttctct 224  Q
    |||||||||||||| ||| |||| ||||||| |||||| |||||  |||||||  ||| ||||||||||    
23025269 agtgaggttgatgggtgatccttccttcgaagcaatccatttgacaagattggagaactcttcttctct 23025337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University