View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11965_low_15 (Length: 252)
Name: NF11965_low_15
Description: NF11965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11965_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14946103 - 14946346
Alignment:
| Q |
1 |
tcatattgataatttgcatcttttaggctatgctctttgcaggatcaaactcaacagctgtaactttagaatgggcaatgtctaatttattaaaccatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14946103 |
tcatattgataatttgcatcttttaggctatgctctttgcaggatcaaactcaacagctgtaactttagaatgggcaatgtctaatttattaaaccatcc |
14946202 |
T |
 |
| Q |
101 |
agaagtgttgaaaaaagcaaaagaggaaatggacacttatataggacaagaccatttgttaaatgaggttgaccttccaaaacttccttaccttaagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14946203 |
agaagtgttgaaaaaagcaaaagaggaaatggacacttatataggacaagaccatttgttaaatgaggttgaccttccaaaacttccttaccttaagaag |
14946302 |
T |
 |
| Q |
201 |
gtcgtcttagagacacttaggatgtaccctccagctcctttgct |
244 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14946303 |
gtcgtcctagagacacttaggatgtaccctccagctccattgct |
14946346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 66 - 103
Target Start/End: Original strand, 5893678 - 5893715
Alignment:
| Q |
66 |
ttagaatgggcaatgtctaatttattaaaccatccaga |
103 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
5893678 |
ttagaatgggctatgtctaatttgttaaaccatccaga |
5893715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University