View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11965_low_22 (Length: 216)
Name: NF11965_low_22
Description: NF11965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11965_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 91 - 211
Target Start/End: Complemental strand, 4484127 - 4484007
Alignment:
| Q |
91 |
taatctacaaagatgatgggtatggtggagattatgggatgctaaccctgttacgtgaagcccttcaagatgtggattcaatgattgagcactgcttaat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4484127 |
taatctacaaagatgatgggtatggtggagattatgggatgctaaccctgttaggtgaagcccttcaagatgtggattcaatgattgagcactgcttaat |
4484028 |
T |
|
| Q |
191 |
ccttcccttgatttcttctct |
211 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4484027 |
ccttcccttgatttcttctct |
4484007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 4489185 - 4488990
Alignment:
| Q |
1 |
cttttctggtgagactagctaacaatggtacgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaatctacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||| | |
|
|
| T |
4489185 |
cttttctggtgagactagctaacactggtacagcatatataaaatgcattgcagaaatagtgcaggcttatagctggaagaaagtagtagtaatctacga |
4489086 |
T |
|
| Q |
101 |
agatgatgggtatggtggagattatgggatgctaaccctgttacgtgaagcccttcaagatgtggattcaatgattgagcactgcttaatccttcc |
196 |
Q |
| |
|
|||| | ||||| ||||||||||| ||||||||| | ||| || ||| || ||||| || ||||| |||||||| |||||| ||||| ||||||| |
|
|
| T |
4489085 |
agataacgggtacggtggagattacgggatgctagctctgctagctgaggcacttcaggacgtggactcaatgatcgagcaccgcttagtccttcc |
4488990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 4485018 - 4484925
Alignment:
| Q |
1 |
cttttctggtgagactagctaacaatggtacgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaat |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4485018 |
cttttctagtgagactagctaacaatggtacgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaat |
4484925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University