View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11965_low_6 (Length: 407)
Name: NF11965_low_6
Description: NF11965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11965_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 30039776 - 30039433
Alignment:
| Q |
1 |
tgtcatcattaattaattttgcttgcttagtgaccaatagaaaagaaatcttgcaacttgttcatcgttcctttccattgatgttgctaagtcatgtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30039776 |
tgtcatcattaattaattttgcttgcttagtgaccaatagaaaagaaatcttgcaacttgttcatcgttcctttccattgatgttgctaagtcatgtgta |
30039677 |
T |
 |
| Q |
101 |
aattatacccaataataaatgatagggtagcatttatatatttattgcatgcacatttaatagagaaatgataggtgtacacgggatccatgcatgtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30039676 |
aattatacccaataataaatgatagggtagcatttatatacctattgcatgcacatttaatagagaaatgataggtgtacatgggatccatgcatgtgta |
30039577 |
T |
 |
| Q |
201 |
aaactttttaa--cnnnnnnnnnnaaagaagctaaactctcttctcttcttctcaaaccccaaccgtcattattttctttttcttgtctaatgaagatga |
298 |
Q |
| |
|
||| ||||||| ||||||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30039576 |
aaattttttaagttttttttttttaaagaagctaacctctcttctctccttttcaaaccccaaccgtcattcctttctttttcttgtctaatgaagatga |
30039477 |
T |
 |
| Q |
299 |
gtgatttatggtcaattttgacccacaatcacccatcagaattg |
342 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |||||| |
|
|
| T |
30039476 |
gtgatttatggtcaattttgacccaaaatcactcatccgaattg |
30039433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 272 - 331
Target Start/End: Original strand, 2968486 - 2968545
Alignment:
| Q |
272 |
tttctttttcttgtctaatgaagatgagtgatttatggtcaattttgacccacaatcacc |
331 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
2968486 |
tttctttttcttgtctattgaagatgagtgatttatggtcaattttgactcaaaatcacc |
2968545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 272 - 342
Target Start/End: Original strand, 7281603 - 7281673
Alignment:
| Q |
272 |
tttctttttcttgtctaatgaagatgagtgatttatggtcaattttgacccacaatcacccatcagaattg |
342 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||||||| |||||||| | ||| | ||||||||||| |||||| |
|
|
| T |
7281603 |
tttcttcttcttgtctattgaagatgaatgatttagggtcaattctaacctaaaatcacccatccgaattg |
7281673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 272 - 332
Target Start/End: Complemental strand, 17767715 - 17767655
Alignment:
| Q |
272 |
tttctttttcttgtctaatgaagatgagtgatttatggtcaattttgacccacaatcaccc |
332 |
Q |
| |
|
|||||| |||||||||| ||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
17767715 |
tttcttcttcttgtctaccgaagatgggtgatttagagtcaattttgacccagaatcaccc |
17767655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 11798654 - 11798620
Alignment:
| Q |
298 |
agtgatttatggtcaattttgacccacaatcaccc |
332 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
11798654 |
agtgatttatggtcaattttgacccaaaatcaccc |
11798620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 323
Target Start/End: Complemental strand, 29927522 - 29927492
Alignment:
| Q |
293 |
agatgagtgatttatggtcaattttgaccca |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29927522 |
agatgagtgatttatggtcaattttgaccca |
29927492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 342
Target Start/End: Original strand, 20411551 - 20411601
Alignment:
| Q |
293 |
agatgagtgatttatggtcaattttgaccc-acaatcacccatcagaattg |
342 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
20411551 |
agatgggtgatttatggtcaattttgacccaaaaatcacccatccgaattg |
20411601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 332
Target Start/End: Complemental strand, 9298610 - 9298517
Alignment:
| Q |
239 |
cttctcttcttctcaaaccccaaccgtcattattttctttttcttgtctaatgaagatgagtgatttatggtcaattttgacccacaatcaccc |
332 |
Q |
| |
|
||||||||||||||||||| ||| ||| |||||| |||||||||| |||||| | |||||||| |||||||||||| ||| | |||||| |
|
|
| T |
9298610 |
cttctcttcttctcaaaccttaactgtcggccatttcttcttcttgtctattgaagaagggtgatttagggtcaattttgaaccaaagtcaccc |
9298517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 342
Target Start/End: Original strand, 53402610 - 53402658
Alignment:
| Q |
295 |
atgagtgatttatggtcaattttgaccc-acaatcacccatcagaattg |
342 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
53402610 |
atgagtgatttaaggtcaattttgacccaaaaatcacccatccgaattg |
53402658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University