View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11966_high_10 (Length: 287)
Name: NF11966_high_10
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11966_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 7753200 - 7753018
Alignment:
| Q |
17 |
tttttcctaaggttgcactatttaattgtcagaaaattggaaaaaaccactacttttggctgagatcctgcaggtagggattggattacttgtacttcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753200 |
tttttcctaaggttgcactatttaattgtcagaaaattggaaaaaaccactacttttggctgagatcctgcaggtagggattggattacttgtacttcag |
7753101 |
T |
|
| Q |
117 |
caattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggttaggtcttcctatcagttcacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7753100 |
caattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggttaggtcttcctatcagttgacaa |
7753018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 7753020 - 7752969
Alignment:
| Q |
236 |
caacatatactttctttttcctaatcttttttcattttatattgcctttgct |
287 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
7753020 |
caacatatactttctttttcctaatattttctcattttatattgccattgct |
7752969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 83 - 178
Target Start/End: Original strand, 32929905 - 32930000
Alignment:
| Q |
83 |
cctgcaggtagggattggattacttgtacttcagcaattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggtta |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
32929905 |
cctgcaggtaggaattggattacttgtacttcagcaattgagtggtatcaatggagttttgttctattcaactagcatctttgcaaatgcaggtta |
32930000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University