View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11966_low_10 (Length: 305)
Name: NF11966_low_10
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11966_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 48307961 - 48307723
Alignment:
| Q |
18 |
aaaacgttatttaattagacacctaacattcaaccactatatcacaattcacaaaaatggtcactaaacactttaagggccgaattatagatatcttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48307961 |
aaaacgttatttaattagacacctaacattcaaccactatatcacaattcacaaaaatggtcactaaacactttaagggccgaattatagatatcttttt |
48307862 |
T |
|
| Q |
118 |
agttagaaattagaaaaacgttatttaatttgatacctaacaatagcaacgattttaaggccactaatttaacattgataaatttagttctcggttttag |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
48307861 |
agttagaaattagaaaaacgttatctaattagatacctaacaatagcaacgattttaaggccactaatttaacattgataaatttagttatcagttttag |
48307762 |
T |
|
| Q |
218 |
agacatatttttgttaaacaacattttggtcaattcttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48307761 |
agacatatttttgttaaacaacattttggtcaattcttt |
48307723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 305
Target Start/End: Complemental strand, 48307711 - 48307678
Alignment:
| Q |
272 |
ttggtctatgtgcagctcgctctcataatgatct |
305 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
48307711 |
ttggtctatgtgcagctcactctcataatgatct |
48307678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University