View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11966_low_14 (Length: 237)

Name: NF11966_low_14
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11966_low_14
NF11966_low_14
[»] chr5 (3 HSPs)
chr5 (94-165)||(27423075-27423146)
chr5 (11-64)||(27423147-27423200)
chr5 (185-223)||(27422892-27422930)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 94 - 165
Target Start/End: Complemental strand, 27423146 - 27423075
Alignment:
94 agatgaggctgcagtgacgcgatgagttttggggctcgtggttgaaatcacagtgttggaattcatgatgtg 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27423146 agatgaggctgcagtgacgcgatgagttttggggctcgtggttgaaatcacagtgttggaattcatgatgtg 27423075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 11 - 64
Target Start/End: Complemental strand, 27423200 - 27423147
Alignment:
11 aataatactgataataggaagcaaaagaatgcttgcagctcgcgaatgtgtgta 64  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
27423200 aataatactgataatgggaagcaaaagaatgcttgcagctcgcgaatgtgtgta 27423147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 27422930 - 27422892
Alignment:
185 accccctacaacacaatttgtcagctacaaagcagtagc 223  Q
    ||||| |||||||||||||||||||||||||||||||||    
27422930 accccgtacaacacaatttgtcagctacaaagcagtagc 27422892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University