View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11966_low_14 (Length: 237)
Name: NF11966_low_14
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11966_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 94 - 165
Target Start/End: Complemental strand, 27423146 - 27423075
Alignment:
| Q |
94 |
agatgaggctgcagtgacgcgatgagttttggggctcgtggttgaaatcacagtgttggaattcatgatgtg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423146 |
agatgaggctgcagtgacgcgatgagttttggggctcgtggttgaaatcacagtgttggaattcatgatgtg |
27423075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 11 - 64
Target Start/End: Complemental strand, 27423200 - 27423147
Alignment:
| Q |
11 |
aataatactgataataggaagcaaaagaatgcttgcagctcgcgaatgtgtgta |
64 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423200 |
aataatactgataatgggaagcaaaagaatgcttgcagctcgcgaatgtgtgta |
27423147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 27422930 - 27422892
Alignment:
| Q |
185 |
accccctacaacacaatttgtcagctacaaagcagtagc |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27422930 |
accccgtacaacacaatttgtcagctacaaagcagtagc |
27422892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University