View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11966_low_15 (Length: 229)
Name: NF11966_low_15
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11966_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 7838183 - 7838381
Alignment:
| Q |
16 |
taggttgtattagcataaaataaaatatagaagaataattgggaacaaatattattgttaattattttgtagttggttggtggggatggtttgtcagtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7838183 |
taggttgtattagcataaaataaaatatagaagaataattgggaacaaatattattgttaattattttgtagttggttggtggggatggtttgtcagtta |
7838282 |
T |
 |
| Q |
116 |
gtgtttttctttttaaagttagttgtggtaaaaatgtaggtgacgttacttgtacattctaagcagtgagaatgtgacacctgcagaggcagagagtga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7838283 |
gtgtttttctttttaaagttagttgtggtaaaaatgtaggtgacgttacttgtacattctaagcagtgagaatgtgacacctgctgaggcagagagtga |
7838381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University