View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11966_low_6 (Length: 382)
Name: NF11966_low_6
Description: NF11966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11966_low_6 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 159 - 382
Target Start/End: Complemental strand, 14634769 - 14634528
Alignment:
| Q |
159 |
taaaaccctagctgccactgctgccatgaatagttttgtttaaccatgggtgtatgtatgcatcttccattc--------------------catttaat |
238 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
14634769 |
taaaaccctagccgccacttctgccatgaatagttttgtttaaccatgggtgcatgtatgcatcttccattctttaatgttagatttcattccatttaat |
14634670 |
T |
|
| Q |
239 |
ttcatttctttctgtttttt------ctgatattggcaaaatcaatctccacttttagaaaccaccaaagatgcagtcttagttgaagacggcctttatt |
332 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||| ||||||||||| | ||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
14634669 |
ttcatttcttactgttttttttctttctgatattggctaaatcc----ccacttttagagaacacca----tgcagtcttggttgaagatggcctttatt |
14634578 |
T |
|
| Q |
333 |
tcttcatcatctactattgttttctttgtttggtctttcatcatcaatta |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14634577 |
tcttcatcatctactattgttttctttgtttggtctttcatcatcaatta |
14634528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 14639862 - 14639797
Alignment:
| Q |
159 |
taaaaccctagctgccactgctgccatgaatagttttgtttaaccatgggtgtatgtatgcatctt |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14639862 |
taaaaccctagctgccacttctgccatgaatagttttgtttaaccatgggtgcatgtatgcatctt |
14639797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University