View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_high_40 (Length: 271)
Name: NF11967_high_40
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 60 - 262
Target Start/End: Complemental strand, 36815162 - 36814958
Alignment:
| Q |
60 |
ggactaattctctggttgcaagtaaataatgaaaagtctacgatcaaatttgagttttgatnnnnnnnt-tcagagggactaataagcat-atacatatt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
36815162 |
ggactaattctctggttgcaagtaaataatgaaaagtctacgatcaaatttgagttttgataaaaaaatctcagagggactaataagcattatacatatt |
36815063 |
T |
 |
| Q |
158 |
ctgttctactggtcctgcatattctgccatataatacgggtctgatattttaacctattgttttatggcttttttgcttttggtttggactattgttcat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36815062 |
ctgttctactggtcctgcatattctgccatataatacgggtctgatattttaacctattgttttatggcttttttgcttttggtttggactattgttcat |
36814963 |
T |
 |
| Q |
258 |
ctcat |
262 |
Q |
| |
|
|||| |
|
|
| T |
36814962 |
gtcat |
36814958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University