View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_high_41 (Length: 270)
Name: NF11967_high_41
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 48310887 - 48310625
Alignment:
| Q |
1 |
taggaccccgtgctgtgaactgacccaccagatattgactcccacaagtctacacaactacatatccatttggccagcacgcctctatatagttggaggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48310887 |
taggaccccgtgctgtgaactgacccaccagatattgactcccacaagtctacacaactacatatccatttggccagcacgccactatatagttggaggc |
48310788 |
T |
|
| Q |
101 |
tccaacttggagcattgtgcatttaatagggatggctaatgatttttaatttttcgggaaattatgaaaattaaataatacactgttttgataatgcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48310787 |
tccaacttggagcattgtgcatttaatagggatggctaatgatttttaatttttcgggaaattatgaaaattaaataatacactgttttgataatgcata |
48310688 |
T |
|
| Q |
201 |
tatatttggttcgagtaatatatatcacttgtttttcttatcacacattgacttcttcatctc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
48310687 |
tatatttggttcgagtaatatatatcacctgtttttctcatcacacattgacttcttcatctc |
48310625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University