View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_high_42 (Length: 246)
Name: NF11967_high_42
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 31 - 236
Target Start/End: Original strand, 40079111 - 40079316
Alignment:
| Q |
31 |
aataaataaattaacagtcatttcaaacatggactttgaaaaccatataaagaatcatcaagacacataaaaagttgatgggttttctacacttctggtt |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40079111 |
aataaataaattaacaatcatttcaaacatggactttgaaaaccatataaagaatcatcaagacacataaaaagttgatgggttttctacacttctggtt |
40079210 |
T |
 |
| Q |
131 |
gtttcttcaactctttccccagtatcacacttgcttctcgttgttgataattttcctgttcatgttttcaactaaccacaatatcaatatgccaccatgg |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40079211 |
gtttcttcaactttttccccagtatcacacttgcttctcgttgttgataattttccagttcatgttttcaattaaccacaatatcaatatgccaccatgg |
40079310 |
T |
 |
| Q |
231 |
ccatct |
236 |
Q |
| |
|
|||||| |
|
|
| T |
40079311 |
ccatct |
40079316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University