View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_high_48 (Length: 239)
Name: NF11967_high_48
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 40078998 - 40078776
Alignment:
| Q |
1 |
gccaaaggaatactaagaggaggtccatgattcaaattttgaaaaccaacatatgcctacaaaaatcaaagtcacggtgcctaatttattcaaactcata |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40078998 |
gccaaaggaatactaagagggggtccaggattcaaattttgaaaaccaacatatgcctacaaaaatcaaagtcacggtgcctaatttcttcaaactcata |
40078899 |
T |
 |
| Q |
101 |
aaattccaaacacatgtgaaatgtactttttgattttgcagttaagtttacccaacacttaagtcattgaacgatgactccaagaggtttatatcggtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40078898 |
aaattccaaacacatgtgaaatgtactttttgattttgcagttaagtttacccaacacttaagtcattgaacgatgactccaacaggtttatatcggtct |
40078799 |
T |
 |
| Q |
201 |
catcttggctctgttgtgatact |
223 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
40078798 |
catcttggctctgctgtgatact |
40078776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 223
Target Start/End: Complemental strand, 40073491 - 40073436
Alignment:
| Q |
168 |
tgaacgatgactccaagaggtttatatcggtctcatcttggctctgttgtgatact |
223 |
Q |
| |
|
|||||| ||| ||||||| ||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
40073491 |
tgaacgttgaatccaagatgttcatattggtctcatcttggctctgttctgatact |
40073436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University