View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_low_17 (Length: 425)
Name: NF11967_low_17
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 17 - 412
Target Start/End: Original strand, 52122224 - 52122619
Alignment:
| Q |
17 |
aaaatcatcgaaatgtacgatttttgtttttgggtctctattcaaatcacaaaccattcatcaaattgttataaattttttgttttgatttcagcattca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52122224 |
aaaatcatcgaaatgtacgatttttgtttttgggtctctattcaaatcacaaaccattcatcaaattgttttaaattttttgttttgatttcagcattca |
52122323 |
T |
 |
| Q |
117 |
aacaggtgattaaagaaccttcacttttgggattgaacaaatttcaaaggactcttatacatgcttctgattccaccgtaaatggtgcattggaagttga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52122324 |
aacaggtgattaaagaaccttcacttttgggattgaacaaatttcaaaggactcttatacatgcttctgattccaccgtaaatggtgcattggaagttga |
52122423 |
T |
 |
| Q |
217 |
actgaaacaaagttccagtgttcctgttaatgtgggttatagtgggttggaaccatttcatggtaaatcaggttctgtctctttttatgggttgacacac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52122424 |
actgaaacaaagttccagtgttcctgttaatgtgggttatagtgggttggaaccatttcatggtaaatcaggttctgtctctttttatgggttgacacac |
52122523 |
T |
 |
| Q |
317 |
caatctgtagaagaagggaagttggtatctgctccgttcaaacaagaggagagctcttacttatgggttttggctcctgttgcattcatatcatct |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52122524 |
caatctgtagaagaagggaagttggtatctgctccgttcaaacaagaggagagctcttacttatgggttttggctcctgttgcattcatatcatct |
52122619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University