View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_low_32 (Length: 341)
Name: NF11967_low_32
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 102 - 319
Target Start/End: Complemental strand, 14495281 - 14495064
Alignment:
| Q |
102 |
agtgcaacaaagtgttgtacaatgtctagtcttagttaacaacatgcaccactttattcactttaatactttgggacattacacgcatgcctagtgaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495281 |
agtgcaacaaagtgttgtacaatgtctagtcttagttaacaacatgcaccactttattcactttaatactttgggacattacacgcatgcctagtgaatt |
14495182 |
T |
|
| Q |
202 |
cgaataatgaactgtatttctcttatatgttttcctttcttttaaagattctcttcctttttcccacaaagatcttctaattctgaaactcttcaacctt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14495181 |
cgaataatgaactgtatttctcttatatgttttcctttcttttaaagattctcttcctttttcccacaaagagcttctaattctgaaactcttcaacctt |
14495082 |
T |
|
| Q |
302 |
ttgtagttttgttcatca |
319 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14495081 |
ttgtagttttgttcatca |
14495064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 14495368 - 14495334
Alignment:
| Q |
15 |
ataggggaagttattttatgttttcattccaagat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495368 |
ataggggaagttattttatgttttcattccaagat |
14495334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University