View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_low_44 (Length: 245)
Name: NF11967_low_44
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 111 - 226
Target Start/End: Original strand, 17656089 - 17656204
Alignment:
| Q |
111 |
catggaaactagtttcaaaggttcgattggaatcaccgctgattcaatgcataactaattttgtatcaatggatttaatggcgaatactctcttatcagc |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17656089 |
catggaaactagtttcaaaggttcgaatggaatcaccgctgattcaatgcataactaatttcgtatcaatggatttaatggcgaatactctcttatcagc |
17656188 |
T |
 |
| Q |
211 |
tggagcatcaccagca |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17656189 |
tggagcatcaccagca |
17656204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 111 - 222
Target Start/End: Complemental strand, 17530447 - 17530336
Alignment:
| Q |
111 |
catggaaactagtttcaaaggttcgattggaatcaccgctgattcaatgcataactaattttgtatcaatggatttaatggcgaatactctcttatcagc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17530447 |
catggaaactagtttcaaaggttcgattggaatcaccactgattcaatgcataactaattttgtatcaatggatttaatggcgaatactctcttatcagc |
17530348 |
T |
 |
| Q |
211 |
tggagcatcacc |
222 |
Q |
| |
|
||| |||||||| |
|
|
| T |
17530347 |
tggtgcatcacc |
17530336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University