View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11967_low_8 (Length: 527)
Name: NF11967_low_8
Description: NF11967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11967_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 2e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 37323108 - 37322957
Alignment:
| Q |
1 |
gatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatataggaagcaaatctgcagggagagagcgtgtgatatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323108 |
gatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatatgggaagcaaatctgcagggagagagcgtgtgatatgct |
37323009 |
T |
|
| Q |
101 |
ttcaatttggaaagccccattgctttgcattttcttgagaaaaagagagaga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37323008 |
ttcaatttggaaagccccattgctttgcattttcttgagaaagagagagaga |
37322957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 144 - 272
Target Start/End: Complemental strand, 37322923 - 37322803
Alignment:
| Q |
144 |
agagagagaaagaatgaatgtgaatcttataggagtaatcaatatgtgtgggccgatagctagggcgaacttgaagtagtacactactaccattcatcta |
243 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
37322923 |
agagagagagagaatgaatgtgaatcttataggagtaa-----atgtgtggcccgatagctagggagaacttgtagtagtacactac---cattcatcta |
37322832 |
T |
|
| Q |
244 |
ctctaaatttttcacttacaaaattcatt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37322831 |
ctctaaatttttcacttacaaaattcatt |
37322803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University