View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11968_high_10 (Length: 248)
Name: NF11968_high_10
Description: NF11968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11968_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 55161979 - 55162217
Alignment:
| Q |
1 |
cttctttcataactcagatggaaaagatgtggatatagatatagcaagtcaatcactgcagccatttactcatcaccaatggagaatcaaccaacaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55161979 |
cttctttcataactcagatggaaaagatgtggatatagatatagcaagtcaatcattgcagccatttactcagcaccaatggagaatcaaccaacaatat |
55162078 |
T |
 |
| Q |
101 |
atcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaac-----aatttggtgtctcataggtaaggtatata |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
55162079 |
atcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaacaatttaatttggtgtctcat-----aggtatata |
55162173 |
T |
 |
| Q |
196 |
ttaaaagatatatagaagaatctaattatagttttgtctctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162174 |
ttaaaagatatatagaagaatctaattatagttttgtctctctg |
55162217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University